View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6597_low_32 (Length: 236)
Name: NF6597_low_32
Description: NF6597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6597_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 3568119 - 3567914
Alignment:
| Q |
1 |
tcaataggcagcatttcccatttcactgcaaataaacaagaagcaaaagttatagtaattaattgcaactcaaattgtaaaagaatgtatatacatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568119 |
tcaataggcagcatttcccatttcactgcaaataaacaagaagcaaaagttatagtaattaattgcaactcaaattgtaaaagaatgtatatacatttga |
3568020 |
T |
 |
| Q |
101 |
tatgttaggggtaaattctattaacccctgccatannnnnnnnnnnnnnnnnnnnnaatatactatgtgcatatattaagtattgacttggtcatcatct |
200 |
Q |
| |
|
| ||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3568019 |
t-----------aaattctattaacccctaccatattttttagtttatttttgtttaatatattatgtgcatatattaagtattgacttggtaatcatct |
3567931 |
T |
 |
| Q |
201 |
acaatatatattaaaca |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3567930 |
acaatatatattaaaca |
3567914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University