View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6598_low_9 (Length: 241)
Name: NF6598_low_9
Description: NF6598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6598_low_9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 34093684 - 34093909
Alignment:
| Q |
19 |
ttatgtactattccaaagtagtcactcatgcaagctgttatttacagcaagttaatcaacctttt-gtacnnnnnnnnnnnnnnnnnnatgaaaattgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||| || |
|
|
| T |
34093684 |
ttatgtactattccaaagtagtcactcatgcaagctgttatttacagcaagttaatgaacctttttgtactttttttctttcttttttatgaaaattctt |
34093783 |
T |
|
| Q |
118 |
gtaagtttatatggtcgt---aactaattaggcatgaacatcggtaagtttatggatgagtttagactaaaccggatcaattagtagcttaaaaattcaa |
214 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34093784 |
gtaagtttatatggtcgtcgtaactaattaggcatgaacatcggtcggtt-atggatgagtttagactaaaccggatcaattagtagcttaaaaattcaa |
34093882 |
T |
|
| Q |
215 |
cataaaatagattagcattaaagaatc |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34093883 |
cataaaatagattagcattaaagaatc |
34093909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University