View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6599_high_5 (Length: 404)
Name: NF6599_high_5
Description: NF6599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6599_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 264 - 307
Target Start/End: Complemental strand, 6371217 - 6371174
Alignment:
| Q |
264 |
cactgtctcaaccttgtcttcaccgtttgtggatcatcatcttc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371217 |
cactgtctcaaccttgtcttcaccgtttgtggatcatcatcttc |
6371174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 264 - 307
Target Start/End: Complemental strand, 33222186 - 33222143
Alignment:
| Q |
264 |
cactgtctcaaccttgtcttcaccgtttgtggatcatcatcttc |
307 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33222186 |
cactgtatcaaccttgtcttcaccgtttgttgatcatcatcttc |
33222143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 20248705 - 20248673
Alignment:
| Q |
18 |
agaaggatggtgtatccagaagaaaaggtagac |
50 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
20248705 |
agaaggatggtgtatccagaggaaaaggtagac |
20248673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University