View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6599_high_8 (Length: 316)
Name: NF6599_high_8
Description: NF6599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6599_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 9 - 298
Target Start/End: Original strand, 26616555 - 26616844
Alignment:
| Q |
9 |
gagatgaagccaacagttccatagcagaagatacacttccacatataagaacattatctgcagttgcaatttcaaaactacccgagcgagttagaataat |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26616555 |
gagaagaagccaacagttccatagcagaagatacacttccacatataagaacattatctgcagttgcaatttcaaaactacccgagcgagttagaataat |
26616654 |
T |
 |
| Q |
109 |
attaagacggcccctgagaggtctgttctcaggagggatagcctcccatgattttctacccatgacaacggcattcttcttcccaggatcagatgtcact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26616655 |
attaagacggcccctgagaggtctgttctcaggagggatagcctcccatgattttctacccatgacaacggcattcttcttcccaggatcagatgtcact |
26616754 |
T |
 |
| Q |
209 |
gttgtgatatcctcaaaaaacttttgatcaataggcaatgtccagggtaattttccatccttagcaatacccatatctcgggttgcaatt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26616755 |
gttgtgatatcctcaaaaaacttttgatcaataggcaatgtccagggtaattttccatccttagcaatacccatatctcgggttgcaatt |
26616844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University