View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6599_low_10 (Length: 307)
Name: NF6599_low_10
Description: NF6599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6599_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 33398188 - 33397907
Alignment:
| Q |
1 |
agaagaaagataagcggacataaataaattattgacagagacaggactgaggtggttttgtttttccacgatttatgaacagaacgcgctaagcactagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
33398188 |
agaagaaagataagcggacataaataaattattgacaga--caggactgaggtggttttgtttttccacgatttatgaacagaacacgctaagtactagt |
33398091 |
T |
 |
| Q |
101 |
atataatatactccaatccaatcaactctgggctaaagaaacacaatcgaatcgaatcgaatcgaagagttagggttaaggagaagaaagaaatgggttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398090 |
atataatatactccaatccaatcaactctgggctaaagaaacacaatcgaca-gaatcgaatcgaagagttagggttaaggagaagaaagaaatgggttc |
33397992 |
T |
 |
| Q |
201 |
cagaagaagaattgcaggagcaggtttacaggatgattgctgggaatatgtgttatccaaactccttaacaacctcaacgttgag |
285 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33397991 |
cagaaaaagaattgcaggagcaggtttacaggatgattgctgggaatatgtgttatccaaactccttaacaacctcaacgttgag |
33397907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 263
Target Start/End: Original strand, 37579466 - 37579515
Alignment:
| Q |
214 |
gcaggagcaggtttacaggatgattgctgggaatatgtgttatccaaact |
263 |
Q |
| |
|
||||||| ||||||| ||| |||||||||||||||||| |||||||||| |
|
|
| T |
37579466 |
gcaggaggtggtttaccggacgattgctgggaatatgtgatatccaaact |
37579515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University