View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6599_low_12 (Length: 273)
Name: NF6599_low_12
Description: NF6599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6599_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 258
Target Start/End: Complemental strand, 26642030 - 26641786
Alignment:
| Q |
14 |
tcatctggttttgctctagaaaccaattcaatgaaatggtacactggtgactggtttaccttttccgaagcacgaatgtttaactccacatggatctaat |
113 |
Q |
| |
|
|||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26642030 |
tcatatggctttgctttagaaaccaattcaatgaaatggtacactggtgactggtttaccttttccgaaacacgaatgtttaactccacatggatctaat |
26641931 |
T |
|
| Q |
114 |
ttcaacagtttcctaagtctgaactctaaacatcctaagtcaccgctccattcatcttcaacacgacggcaacctgctcctcaccatttatcttcgccgt |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||| |
|
|
| T |
26641930 |
ttcaaccgtttcctaagtctgaactctaaacatcctaagtcaccgctccattcatcttcaacacgacggcaacctgctccccaccatttaccttcgtcgt |
26641831 |
T |
|
| Q |
214 |
ctctggcggtgccaaactgtttgctacccttcatcttcatcattc |
258 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26641830 |
ctctggcggtgccaaactgttcgctacccttcatcttcatcattc |
26641786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University