View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6599_low_15 (Length: 260)
Name: NF6599_low_15
Description: NF6599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6599_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 31714122 - 31714367
Alignment:
| Q |
1 |
tagattctgaaatccattaccataaacttcatctttatctttctcttcagaatttgtttttgcataattcaattgccttgcaaaagaagacacactccta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31714122 |
tagattctgaaatccattaccataaacttcatctttatctttctcttcagaatgtgtttttgcataattcaattgccttgcaaaagaagacacactccta |
31714221 |
T |
 |
| Q |
101 |
tgtggatttttcaacgaaacatcactacctaaattatgctcctagaaaatcaaccacagtaagcatccatacaaaactgaatcaactataataa---aac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31714222 |
tgtggatttttcaacgaaacatcactacctaaattattttcctagaaaatcaaccacagtaagcatccatacaaaactgaatcaactataataaaacaac |
31714321 |
T |
 |
| Q |
198 |
cttaaaaataaaccctagctttatatcaatgacaacgcatatagat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31714322 |
cttaaaaataaaccctagctttatatcaatgacaacgcatatagat |
31714367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University