View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6599_low_16 (Length: 254)

Name: NF6599_low_16
Description: NF6599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6599_low_16
NF6599_low_16
[»] chr7 (1 HSPs)
chr7 (19-71)||(47367175-47367227)


Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 47367227 - 47367175
Alignment:
19 ggatgtacttcctttttgtaatactggatgcaagatcgagtacatatatggct 71  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
47367227 ggatgtacttcctttttgtaatactggatgcaagatcgagtacatatatggct 47367175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University