View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6599_low_19 (Length: 249)
Name: NF6599_low_19
Description: NF6599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6599_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 33 - 226
Target Start/End: Original strand, 3250251 - 3250445
Alignment:
| Q |
33 |
gagagaattttttaggtatgtgttgttattaaagtttaaatatatgcttgatgtctataaatataacaatgttagttttagtcatgtaagttatacttgc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3250251 |
gagagaattttttaggtatgtgttgttattaaagtttaaatatatgcttgatgtctataaatataacaatgttagttttagtcatgtaagttatacttgc |
3250350 |
T |
 |
| Q |
133 |
gt-nnnnnnnnntgtcatgtaagttgttttggatttcatcatacttcaaaagttagaaatgatgatttttagtccttaacatcaacaatcgttat |
226 |
Q |
| |
|
|| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3250351 |
gtaaaaaaaaaatgtcatgcaagttgttttggatttcatcatacttcaaaagttagaaatgatgatttttagtccttaacatcaacaatcgttat |
3250445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University