View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6599_low_2 (Length: 457)
Name: NF6599_low_2
Description: NF6599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6599_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 2e-93; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 33397789 - 33397993
Alignment:
| Q |
18 |
tacacaaggtatgatgtggccattggctagaaatgggaagaagattatgtgaagttcttgattttcgctacccatggtgagtttagagagttctggattt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||| | ||||||||||||| |
|
|
| T |
33397789 |
tacacaaggtatgatgtggccattggctagaaatgggaagaagattatgtgaagttcttgattttcgttagtcatggtgaattt-gtgagttctggattt |
33397887 |
T |
 |
| Q |
118 |
ttgcaatgagagggaaaagatgaagactatgctaaagttttgttgcttatataaagatgaattaatcattgaaaaataaagttttgcaatcgcgttttgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33397888 |
ttgcaatgagagggaaaagatgaagactatgctaaagttttgttgcttatataaagatgaattaatcattgaaaaataaagttttgcaatcgcgttttac |
33397987 |
T |
 |
| Q |
218 |
acgggc |
223 |
Q |
| |
|
|||||| |
|
|
| T |
33397988 |
acgggc |
33397993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 305 - 398
Target Start/End: Original strand, 33398072 - 33398164
Alignment:
| Q |
305 |
ctaacacttggctatggtacaaacatgcatggatgagatctgttcaccacgcagtccacgagctcattttaaaaatagcagagtgctactgtta |
398 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398072 |
ctaacacttggctatggtacaa-catgcatggatgagatctgttcaccacgcagtccacgagctcattttaaaaatagcagagtgctactgtta |
33398164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 417 - 446
Target Start/End: Original strand, 33398180 - 33398209
Alignment:
| Q |
417 |
gactaaagcagagtgctaatgttttatttt |
446 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33398180 |
gactaaagcagagtgctaatgttttatttt |
33398209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University