View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6600_low_7 (Length: 299)
Name: NF6600_low_7
Description: NF6600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6600_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 1016207 - 1015917
Alignment:
| Q |
1 |
tcgtttcgtttgtgttattttcttagtgacgctaatgtgtcggtgttggtgtgtttttgttggcacttcgtagatgaaatgttctttagagtttaattac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1016207 |
tcgtttcgtttgtgttattttcttagtgacgttaatgtgtcggtgttggtgtgtttttgttggcacttcatagatgaaatgttctttagagtttaattac |
1016108 |
T |
|
| Q |
101 |
attcaattatgtaatttttctcgaattattgttgagatcaatgtgttggtgttagtgtgtttgtgtcggtgcttggtttagagtttaaattcgacgatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1016107 |
attcaattatgtaatttttctcgaattattgttgatatcaatgtgttggtgttagtgtgtttgtgtcggtgcttggtttagagtttaaattcgacgatgt |
1016008 |
T |
|
| Q |
201 |
aagtgtagaaagatttgtgcatgaattgcaactaattatttg--tgacttttgaattggttgtggtaaaagttgaatgtgtctgatgatgt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1016007 |
aagtgtagaaagatttgtgcatgaattgcaactaattatttgtatgacttttgaattggttgtggtaaaagttgaatgtgtctgatgatgt |
1015917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University