View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6602_high_1 (Length: 237)
Name: NF6602_high_1
Description: NF6602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6602_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 36536784 - 36536581
Alignment:
| Q |
18 |
aagggttgtgatcaaaatttgattttgaagggacatttgttttggactgagaacaatgtgacaatggaaggaaccttgttttggattgctatggaggtaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36536784 |
aagggttgtgatcaaaatttgattttgaagggacatttgttttggactgagaacaatgtgacaatggaaggaaccttgttttggattgctatggaggtaa |
36536685 |
T |
|
| Q |
118 |
ctgaaaaggttagtcatgaagtgattatctcttttaattcaattgacaatgttattagcaagattgagttgccgattaattcttttaaagactgtgatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36536684 |
ctgaaaaggttagtcatgaagtgattatctcttttaattcaattgacaatgttattagcaagattgagttgccgattaatccttttaaagactgtgatga |
36536585 |
T |
|
| Q |
218 |
agtt |
221 |
Q |
| |
|
|||| |
|
|
| T |
36536584 |
agtt |
36536581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University