View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6603_low_9 (Length: 237)

Name: NF6603_low_9
Description: NF6603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6603_low_9
NF6603_low_9
[»] chr1 (1 HSPs)
chr1 (14-229)||(35867773-35867988)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 229
Target Start/End: Original strand, 35867773 - 35867988
Alignment:
14 atcatgatctaggcctcggtgagaaccatgaaattgaaatgggatcagcccacgagcatcaattgggacaaacgcatgagcatgaactggacttgggacc 113  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
35867773 atcatgatctaggtctcggtgagaaccatgaaattgaaatgggatcagcccacgagcatcaattgggacaaactcatgagcatgaactggacttgggacc 35867872  T
114 aacccatgaacatgaactggacttgggacaaacccatgagcatgtactggacttgggacatgatattgacaataacatgggattagaacaaaatcattgt 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |    
35867873 aacccatgaacatgaactggacttgggacaaacccatgagcatgtactggacttgggacatgatattgacaataacatgggattagaacaaaatcatgct 35867972  T
214 caagaaggtgatgatg 229  Q
    ||||||||||||||||    
35867973 caagaaggtgatgatg 35867988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University