View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6604_high_20 (Length: 218)
Name: NF6604_high_20
Description: NF6604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6604_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 10 - 182
Target Start/End: Complemental strand, 43379311 - 43379136
Alignment:
| Q |
10 |
gagagaaatgaatagtgaggaagnnnnnnntctttggtctgcaaagagtgttaaaa---gatcaaaagatgcatccgaagagaggaatatatggcttctt |
106 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43379311 |
gagagaaatggatagtgaggaagaaaaaaatctttggtctgcaaagagtgttaaaaaaagatcaaaagatgcatccgaagagaggaatatacggcttctt |
43379212 |
T |
 |
| Q |
107 |
acgagaaatcgaagcaaaattgtgaatcttgaaaggcttcttctaccgtaatcatagactcttatacctaaagtgc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43379211 |
acgagaaatcgaagcaaaattgtgaatcttgaaaggcttcttctaccgtaatcatagattcttatacctaaagtgc |
43379136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University