View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6604_high_21 (Length: 210)
Name: NF6604_high_21
Description: NF6604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6604_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 30 - 196
Target Start/End: Complemental strand, 43104531 - 43104365
Alignment:
| Q |
30 |
atattttattcaccgtttctatatattgttgatgactaatgaacgtggcatgcctttggaggaagatctggtcaatttttctttaatatttaaattttga |
129 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43104531 |
atattttactcaccgtttctatatattgttgatgactaatgaacgtggcatgcctttggaggaagatctggtcaatttttctttaatattttaattttga |
43104432 |
T |
|
| Q |
130 |
tgatattgaaattttttgcattgtctctgtttatattattatattgcatactgtctatgttctatgt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43104431 |
tgatattgaaattttttgcattgtctctgtttatattattatattgcatactgtctatgttctatgt |
43104365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University