View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6604_low_16 (Length: 252)
Name: NF6604_low_16
Description: NF6604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6604_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 5 - 233
Target Start/End: Complemental strand, 23982708 - 23982480
Alignment:
| Q |
5 |
tagtggatttgatctaagtggtaaaaagacatgatttggatctaaattttttggatttgaactctacttttgtctttgaatgaagataaaattaaattta |
104 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23982708 |
tagtggatttggtctaagtggtaaaaagacatgatttggatctaaattttttggatttgaactctacttttgtctttgaatgaagataaaattaaattta |
23982609 |
T |
 |
| Q |
105 |
tttgtaagtgttttttgagtagcattagattgagttaagggcatcgttctctaatttcaaannnnnnnatcaaaaaagttactttaatattgggaatgag |
204 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
23982608 |
tttgtaagtgtttttttagtagcattagattgagttaagggcatcgttccctaatctcaaatttttttatcaaaaaagatactttaatatttggaatgag |
23982509 |
T |
 |
| Q |
205 |
agttgaagatataaaaatgataatattga |
233 |
Q |
| |
|
|||||||||||||||||| ||| |||||| |
|
|
| T |
23982508 |
agttgaagatataaaaattatagtattga |
23982480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University