View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6604_low_20 (Length: 243)
Name: NF6604_low_20
Description: NF6604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6604_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 13 - 228
Target Start/End: Original strand, 17880889 - 17881103
Alignment:
| Q |
13 |
aatattgagtggccttagaaacaattttgttaaaaggaacttcatttgaatcttagagtattatttcttgcacgtatcccgtactcacaaatgacaaata |
112 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17880889 |
aatattgagtgaccttagaaacaattttgttaaaag-aatttcatttgaatcttagaatattatttcttgcacgtattccgtactcacaaatgacaaata |
17880987 |
T |
 |
| Q |
113 |
tctaccttccatccatactaataagggaaacataccaaatccatacaaataaacatgccaaatacttgccgcctctcaagaaagaaagnnnnnnncatac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
17880988 |
tctaccttccatccatactaataagggaaacctaccaaatccatactaataaacatgccaaatacttgccgccgctcaagaaagaaaggaaaaaacatac |
17881087 |
T |
 |
| Q |
213 |
caaattactcaaagat |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17881088 |
caaattactcaaagat |
17881103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University