View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6604_low_23 (Length: 230)
Name: NF6604_low_23
Description: NF6604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6604_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 190
Target Start/End: Original strand, 40237597 - 40237774
Alignment:
| Q |
13 |
atcatcaactccctccatagcgctgttgatattctccctgtcttcgttgctgctgcttcttcccctaacaacacccctgagtggaaaggtgcttgctttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40237597 |
atcatcaactccctccatagcgctgttgatattctccctgtcttcgttgctgctgcttcttcccctaacaacacccctgagtggaaaggtgcttgctttt |
40237696 |
T |
 |
| Q |
113 |
acaagaatcaagcttggatggagtttcataataaaactggttcccaatttggtggtggtacccttcacttaaaggtcg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40237697 |
acaagaatcaagcttggatggagtttcataataaaactggttcccaatttggtggtggtacccttcacttaaaggtcg |
40237774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University