View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6605_low_6 (Length: 206)
Name: NF6605_low_6
Description: NF6605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6605_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 75 - 190
Target Start/End: Original strand, 46660269 - 46660384
Alignment:
| Q |
75 |
atgatgagtaaaattttagatatggggtgctacataagttgccataccttgttgatagccagaggatttcctaggacttgcagcaccaattcgcatcgcc |
174 |
Q |
| |
|
|||| |||| |||||| ||||||| | |||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
46660269 |
atgaagagtgaaatttcagatatgagacgctatataagttgccctaccttgttgatagccagaggatttcctaggagttgcagcaccaattcgcattgcc |
46660368 |
T |
|
| Q |
175 |
ctgctagaacagaaaa |
190 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46660369 |
ctgctagaacagaaaa |
46660384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 5638441 - 5638407
Alignment:
| Q |
1 |
acccacgcccaaatagaacttttcagtacatactg |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5638441 |
acccacgcccaaatagaacttttcagtacatactg |
5638407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 186
Target Start/End: Complemental strand, 6174249 - 6174180
Alignment:
| Q |
117 |
cataccttgttgatagccagaggatttcctaggacttgcagcaccaattcgcatcgccctgctagaacag |
186 |
Q |
| |
|
||||||| |||||| |||||| |||||||| ||| |||||||||| || ||||| | ||||||||||||| |
|
|
| T |
6174249 |
catacctggttgatggccagatgatttccttggagttgcagcaccgatacgcatgggcctgctagaacag |
6174180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University