View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6606_low_10 (Length: 224)
Name: NF6606_low_10
Description: NF6606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6606_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 49900759 - 49900565
Alignment:
| Q |
17 |
atatggaacacaacttattgggtgattacagaactcatggactagccacccattgtaatctttcaaactaaattttctaagttgactacacatgttacca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49900759 |
atatggaacacaacttattgggtgattacagaactcatggactagccacccattgtaatctttcaaactaaattttctaagttgactacacatgttacca |
49900660 |
T |
|
| Q |
117 |
agggtgtcaatcaagttaaatgtaagacaaggcaatgatattatggggaaatctaaatccaacaatatttactgatacatagagctatgcagcac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49900659 |
agggtgtcaatcaagttaaatgtaagacaaggcaatgatattatggggaaatctaaatccaacaatatttactgatacatggagctatgcagcac |
49900565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University