View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6607_high_11 (Length: 351)
Name: NF6607_high_11
Description: NF6607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6607_high_11 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 120 - 351
Target Start/End: Original strand, 39918352 - 39918583
Alignment:
| Q |
120 |
ttccaatcatgtccctgttttcacaaaactagcctacgttttaggcttaagagtttctccaaatcatagaagaatgggaatagggctaaaactggtagag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918352 |
ttccaatcatgtccctgttttcacaaaactagcctacgttttaggcttaagagtttctccaaatcatagaagaatgggaatagggctaaaactggtagag |
39918451 |
T |
|
| Q |
220 |
aaaatggaacaatggtttcgtgaaaatggtgctgagtattcttacatggctactgaaaacgacaacgttgcatcagttaaacttttcaccgacaaatgcg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918452 |
aaaatggaacaatggtttcgtgaaaatggtgctgagtattcttacatggctactgaaaacgataacgttgcatcagttaaacttttcaccgacaaatgcg |
39918551 |
T |
|
| Q |
320 |
gttactcaaagttccgtacaccgtcaatcctt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39918552 |
gttactcaaagttccgtacaccgtcaatcctt |
39918583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 9 - 71
Target Start/End: Original strand, 39918241 - 39918303
Alignment:
| Q |
9 |
agcagagataggcaatgagacagtcggaatgatacgaggttgtatcaaaaccgttacatgcgg |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918241 |
agcagagataggcaatgagacagtcggaatgatacgaggttgtatcaaaaccgttacatgcgg |
39918303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 5545517 - 5545465
Alignment:
| Q |
295 |
gttaaacttttcaccgacaaatgcggttactcaaagttccgtacaccgtcaat |
347 |
Q |
| |
|
|||||||| ||||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
5545517 |
gttaaactcttcactgaaaaatgcggttatacaaagttccgtacaccgtcaat |
5545465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University