View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6607_high_13 (Length: 287)
Name: NF6607_high_13
Description: NF6607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6607_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 47 - 270
Target Start/End: Original strand, 55280482 - 55280705
Alignment:
| Q |
47 |
ttcattgttttcaatgttttaacctatacttcagaattcctttgctgtgattttttcactgtatttctgcaatgttttagagactgatttatgtatttcc |
146 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55280482 |
ttcattgttttcattgttttaacctatacttcagaattcctttgctgtgattttttcactttatttgtgcaatgttttagagactgatttatgtatttcc |
55280581 |
T |
|
| Q |
147 |
ccatgatgtgttatcattgtannnnnnnnnnnnnnnnnnatcacggttcctttgctgtgattttttcctc-ttattgccccatgannnnnnnactgtatt |
245 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
55280582 |
ccatgatgtgttatcattgta-ttttttagcctttttttatcacggttcctttgctgtgattttttcctctttattgccccatgatttttttactgtatt |
55280680 |
T |
|
| Q |
246 |
tctgcattgttttagagagtgattt |
270 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
55280681 |
tctgcattgttttagagagtgattt |
55280705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 55280358 - 55280408
Alignment:
| Q |
1 |
tttaagcataccaaaactcctcaaacactatgcacaaataattgccttcat |
51 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
55280358 |
tttaagcataccaatactgctcaaacactatgcacaaataattgccttcat |
55280408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 34665583 - 34665623
Alignment:
| Q |
8 |
ataccaaaactcctcaaacactatgcacaaataattgcctt |
48 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
34665583 |
ataccaaaactgctcaaacactaagcacaaataattgcctt |
34665623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 94 - 138
Target Start/End: Original strand, 55280663 - 55280707
Alignment:
| Q |
94 |
tgattttttcactgtatttctgcaatgttttagagactgatttat |
138 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| |||||||| |
|
|
| T |
55280663 |
tgatttttttactgtatttctgcattgttttagagagtgatttat |
55280707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University