View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6607_high_14 (Length: 238)
Name: NF6607_high_14
Description: NF6607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6607_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 54 - 222
Target Start/End: Complemental strand, 33328277 - 33328109
Alignment:
| Q |
54 |
aacataaagtaaaagaaaacatgacnnnnnnnnncttttgatgaccagaagaaagcatacttgaaattttgcttattacagtttaccaatgaaaaaagaa |
153 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33328277 |
aacataaagtaaaagaaaacatgactttttttc-cttttgatgaccagaagaaagcatacttgaaattttgcttattacagtttaccaatgaaaaaagaa |
33328179 |
T |
 |
| Q |
154 |
gttgatcttaaac-aatttacaattcaaattaaatcacataatcaccacccaatctccattactcttcat |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33328178 |
gttgatcttaaacaaatttacaattcaaattaaatcacataatcaccacccaatctccattactcttcat |
33328109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University