View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6607_low_17 (Length: 238)

Name: NF6607_low_17
Description: NF6607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6607_low_17
NF6607_low_17
[»] chr5 (1 HSPs)
chr5 (54-222)||(33328109-33328277)


Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 54 - 222
Target Start/End: Complemental strand, 33328277 - 33328109
Alignment:
54 aacataaagtaaaagaaaacatgacnnnnnnnnncttttgatgaccagaagaaagcatacttgaaattttgcttattacagtttaccaatgaaaaaagaa 153  Q
    |||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33328277 aacataaagtaaaagaaaacatgactttttttc-cttttgatgaccagaagaaagcatacttgaaattttgcttattacagtttaccaatgaaaaaagaa 33328179  T
154 gttgatcttaaac-aatttacaattcaaattaaatcacataatcaccacccaatctccattactcttcat 222  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33328178 gttgatcttaaacaaatttacaattcaaattaaatcacataatcaccacccaatctccattactcttcat 33328109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University