View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6607_low_7 (Length: 401)
Name: NF6607_low_7
Description: NF6607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6607_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 9e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 265 - 366
Target Start/End: Complemental strand, 30316233 - 30316132
Alignment:
| Q |
265 |
ccgagaattttgcaaggctcaactaaacatagagcctctttatttggataaataaacgaaatgacaatagataactgagagctcacatataaaaatttat |
364 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30316233 |
ccgagaactttgcaaggctcaactaaacatagagcctctttatttgggtaaataaacgaaatgacaatagataactgagagctcacatataaaaatttat |
30316134 |
T |
|
| Q |
365 |
ga |
366 |
Q |
| |
|
|| |
|
|
| T |
30316133 |
ga |
30316132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 30316499 - 30316426
Alignment:
| Q |
1 |
aaacaaaaaatggttnnnnnnnccatgttgccttgcatgcatatctttggttgttctataagtcgtcaaaagat |
74 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
30316499 |
aaacaaaaaatggttaaaaaaaccatgttgccttacatgcatatctttggttgtcctataagttgtcaaaagat |
30316426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University