View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6608_low_3 (Length: 329)
Name: NF6608_low_3
Description: NF6608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6608_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 19 - 317
Target Start/End: Original strand, 27120299 - 27120597
Alignment:
| Q |
19 |
aaaacctacaaatttggactttgctcaagctgcttctctacctcttgctattgagactgcttatgaaggtttggagaggactggattttcttctggtaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27120299 |
aaaacctacaaatttggactttgctcaagctgcttctctacctcttgctattgagactgcttatgaaggtttggagaggactggattttcttctggtaaa |
27120398 |
T |
|
| Q |
119 |
tctattcttgttctcaatggttctggtggagttggaagcctagtgattcaggtatttactccacaaattagtccttttatgctgaagtattttagcaacc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27120399 |
tctattcttgttctcaatggttctggtggagttggaagcctagtgattcaggtatttactccacaaattagtccttttatgctgaagtattgtagcaacc |
27120498 |
T |
|
| Q |
219 |
gacacttcacgacaccaacacatgtgatgattacattaaattattaccattttctcaaattataaccgatacaatgtgtcagtatcttgtctggtgtct |
317 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27120499 |
gacacttcatgacaccaacacatgtgatgattacattaaattattaccattttctcaaattataattgatacaatgtgtcagtatcttgtctggtgtct |
27120597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University