View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6609_low_5 (Length: 219)

Name: NF6609_low_5
Description: NF6609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6609_low_5
NF6609_low_5
[»] chr8 (1 HSPs)
chr8 (22-207)||(45306992-45307172)


Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 207
Target Start/End: Complemental strand, 45307172 - 45306992
Alignment:
22 ctagcaataatatatttgacaactagtagctagcttagctagcaatgacaatgagaacagaaatgacaatactgattagggcttttatggacagtgcagt 121  Q
    |||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45307172 ctagcaataatatatttgacaactagtagctagct-----agcaatgacaatgagaacagaaatgacaatactgattagggcttttatggacagtgcagt 45307078  T
122 atgttatgtagtggggagatgagatatgcacaatcaatattagagagaggggggtcacagacacaatagacacattgctctctgct 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
45307077 atgttatgtagtggggagatgagatatgcacaatcaatattagagagaggggggtcacagacacaatagacacattgctctgtgct 45306992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University