View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6610_low_2 (Length: 228)
Name: NF6610_low_2
Description: NF6610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6610_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 48097725 - 48097553
Alignment:
| Q |
18 |
agttcaaatgggtccttgagcttaggcatatggcgggtccttgtgatgctttggagatcatggatcattatgtgaccacaaaaccatgtgcataagtgcc |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48097725 |
agttcaagtgggtccttgagcttaggcatatggcgggtccttgtgatgctttggagctcatggatcattatgtgaccacaaaaccatgtgcataagtgcc |
48097626 |
T |
|
| Q |
118 |
aacaacaccccatggtttgatatgcctcttgtttggatatgaagacagtgttttgtgtcgtcttattcggcct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48097625 |
aacaacaccccatggtttgatatgcctcttgtttggatatgaagacagtgttttgtgtcgtcttattcggcct |
48097553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University