View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6612_high_11 (Length: 252)
Name: NF6612_high_11
Description: NF6612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6612_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 15 - 235
Target Start/End: Original strand, 49697713 - 49697933
Alignment:
| Q |
15 |
aatatcaacggaatttgattttttgaaaacaactatgtaatttaatatttttctattttagtttctcgatcaatttgaccttccaaaatgtttacatgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49697713 |
aatatcaacggaatttgattttttgaaaacaactatgtaatttaatatttttctattttagtttctcgatcaatttgaccttccaaaatgtttacatgat |
49697812 |
T |
 |
| Q |
115 |
gtacacacgtgaatgtgacttctgaactaaatgcaaaacacgaacatgacttcctcagtaatctgtggttttcattttagggtatgatgagcctgcgaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49697813 |
gtacacacgtgaatgtgacttctgaactaaatgcaaaacacgaacatgacttcctcagtaatctgtggttttcattttagggtatgatgagcctacgaag |
49697912 |
T |
 |
| Q |
215 |
attgatcatccccataatata |
235 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49697913 |
attgatcatccccataatata |
49697933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University