View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6612_high_13 (Length: 226)
Name: NF6612_high_13
Description: NF6612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6612_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 48102541 - 48102347
Alignment:
| Q |
18 |
gaagcattgtttgattagtgacaaagatgaaggttgcaacagaactgtgcannnnnnngttcaacacatcttgccttgtacttatttcaggtttcttttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48102541 |
gaagcattgtttgattagtgacaaagatgaaggttgcaacagaactgtgcatatttttgttcaacacatcctgccttgtacttatttcaggtttcttttt |
48102442 |
T |
 |
| Q |
118 |
gtccctcactctaactactctttactgtcccttttctctaataacttatcttttcaacacacatgcagggttccaactccaatctatgccctatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
48102441 |
gtccctcactctaactactctttactgtcccttttctctaataacttatcttttcaacacacatgcagggctccaactccaatctatgccttatg |
48102347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 48070046 - 48069852
Alignment:
| Q |
18 |
gaagcattgtttgattagtgacaaagatgaaggttgcaacagaactgtgcannnnnnngttcaacacatcttgccttgtacttatttcaggtttcttttt |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48070046 |
gaagcattgtttgattagtgacaatgatgaaggttgcaacagaactgtgcatatttttgttcaacacatcctgccttgtacttatttcaggtttcttttt |
48069947 |
T |
 |
| Q |
118 |
gtccctcactctaactactctttactgtcccttttctctaataacttatcttttcaacacacatgcagggttccaactccaatctatgccctatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
48069946 |
gtccctcactctaactactctttactgtcccttttctctaataacttatcttttcaacacacatgcagggctccaactccaatctatgccttatg |
48069852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University