View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6612_high_9 (Length: 265)
Name: NF6612_high_9
Description: NF6612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6612_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 26461190 - 26460939
Alignment:
| Q |
1 |
tagtgggaagattgagagattgtattggtcagtgagtgcaagttatgtcatgagagccaatcctggttattatgtgtcactcatcatgccattgcctcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26461190 |
tagtgggaagattgagagattgtattggtcagtgagtgcaagttatgtcatgagagcaaatcctggttattatgtgtcactcatcatgccattgcctcaa |
26461091 |
T |
 |
| Q |
101 |
gaacaagaaggagagaatagtagtaataatgaggtgaagaagcctgtgcttttcactcgtgttaagttgcttaagcctgatgacactctcactttaggac |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26461090 |
gaacaagaaggagagaatagta---ataatgaggtgaagaagcctgtgcttttcactcgtgttaagttgcttaagcctgatgacactctcactttaggac |
26460994 |
T |
 |
| Q |
201 |
atgcttataggctcatcacaactcaaggtagtttctttgttttcaatggtctgtg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26460993 |
atgcttataggctcatcacaactcaaggtagtttctttgttttcaatggtctgtg |
26460939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 15406954 - 15406879
Alignment:
| Q |
155 |
actcgtgttaagttgcttaagcctgatgacactctcactttaggacatgcttataggctcatcacaactcaaggta |
230 |
Q |
| |
|
||||||||||||||||||| |||| |||| ||||| | | | || |||||||||||||||||||| | |||||||| |
|
|
| T |
15406954 |
actcgtgttaagttgcttaggcctaatgaaactcttaatcttggtcatgcttataggctcatcactaatcaaggta |
15406879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University