View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6612_low_17 (Length: 201)
Name: NF6612_low_17
Description: NF6612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6612_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 11572623 - 11572451
Alignment:
| Q |
20 |
ataacgtaatcatgttactgtcttattaaacatgtttggtaataccattcttagtatcttaccgttgcatttgtacaactgaagctagaaactcgaccct |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11572623 |
ataacataatcatgttactgtcttattaaacatgtttggtaataccattcatagtatcttaccgttgcatttgtacaactgaagctagaaactcgacctt |
11572524 |
T |
 |
| Q |
120 |
ctgcacctcggtagaatctgaagaatggtaagacatgaatgtgcagactttcacacatagttctctgctcctc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| ||||||| |
|
|
| T |
11572523 |
ctgcacctcggtagaatctgaagaatggtaagacatgaatgtgcaaactttcacacatacttctcagctcctc |
11572451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University