View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6616_high_10 (Length: 228)
Name: NF6616_high_10
Description: NF6616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6616_high_10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 6 - 228
Target Start/End: Complemental strand, 42237920 - 42237698
Alignment:
| Q |
6 |
acgatgaggcgagaagtgcttttgagagtgctgtgttgaaactgagaaccagtggggaaagaaaatctgcnnnnnnnggtgttgttttgaatcagatggg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42237920 |
acgatgaggcgagaagtgcttttgagagtgctgtgttgaaactgagaactagtggggaaagaaaatctgctttttttggtgttgttttgaatcagatggg |
42237821 |
T |
|
| Q |
106 |
attggcttgtgtgcaattgtttaagatagatgaagctgctgaattgtttgaggaagctaggggaattcttgaacaagaatgtggaccttgtcatcaagat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42237820 |
attggcttgtgtgcaattgtttaagatagatgaagctgctgaattgtttgaggaagctaggggaattcttgaacaagaatgtggaccttgtcatcaagat |
42237721 |
T |
|
| Q |
206 |
actctcggtgtatatagcaatct |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42237720 |
actctcggtgtatatagcaatct |
42237698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University