View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6617_low_11 (Length: 314)
Name: NF6617_low_11
Description: NF6617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6617_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 19 - 308
Target Start/End: Original strand, 36540373 - 36540662
Alignment:
| Q |
19 |
actgtcttgcttgatttccttaacaacaaacaaaataccagaaaaacaagcagctagcaagatgatgatgcacaccatgtataaataattagaaagatac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36540373 |
actgtcttgcttgatttccttaacaacaaacaaaataccagaaaaacaagcagctagcaagatgatgatgcacaccatgtataaataatcagaaagatac |
36540472 |
T |
 |
| Q |
119 |
aaattaacatgtatttgtgctattctatttcatgttgctatttaattaattattatatatagattgttttnnnnnnnttaattatatatagatagttgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
36540473 |
aaattaacatgtatttgtgctattctatttcatgttgctatttaattaattattatatatagattgttttaaaaaaattaattatatatagatggttgat |
36540572 |
T |
 |
| Q |
219 |
tacattttcctcttgaatttgcttttcgtcagatttcaatgtttggaatacaaaggtaaagataaccatttaaatttcatttcatctcac |
308 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36540573 |
tacattttcctcttgaatttgcttttcgttagatttcaatgtttggaatacaaaggtaaagataaccatttaaatttcatttcatttcac |
36540662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University