View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6617_low_15 (Length: 253)
Name: NF6617_low_15
Description: NF6617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6617_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 22 - 234
Target Start/End: Complemental strand, 14576394 - 14576182
Alignment:
| Q |
22 |
taaaccgtcgattctgtaactaacagtaatgcaacacacaaatcagtaggcgttgaattaaaatgccattgccagccactgagccacaatttattaaaca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14576394 |
taaaccgtcgattctgtaactaacagtaatgcaacacataaatcagtaggcgttgaattaaaatgccattgccagccactgagccacaatttattaaaca |
14576295 |
T |
 |
| Q |
122 |
acagttcaagcactaaaactttcctataatttcaatatgaagtactcagaaataatggagaagaatcaatatctattcatacaaaaatgttcccagtcca |
221 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14576294 |
atagttcaagcactaaaactttcctataatttcaatatgaagtactcagaaataatggagaagaatcaatatctattcatacaaaaatgttcccggtcca |
14576195 |
T |
 |
| Q |
222 |
gggagtacctgac |
234 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14576194 |
gggagtacctgac |
14576182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University