View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6617_low_16 (Length: 252)
Name: NF6617_low_16
Description: NF6617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6617_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 7 - 204
Target Start/End: Original strand, 25413267 - 25413471
Alignment:
| Q |
7 |
tgagaagaattgaaatctatgagaggtggtggttctttggtcatgcttgtctaataaaagtgacttggcttata-------gttccatcttcaatgaata |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25413267 |
tgagaagaactgaaatctatgagaggtggtggttctttggtcatgcttgtctaatataagtgacttggcttatagactatagttccatcttcaatgaata |
25413366 |
T |
 |
| Q |
100 |
gtcaaatacgatggctatacgtagcttgtctcgacacttgatattcgttaacaaaacaagagtagatatgaaaaagacaaacttactttaatatgatatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25413367 |
gtcaaatacgatggctatacgtagcttgtctccacacttgatattcgttaacaaaacaagagtagatatgaaaaagacaaatttactttaatatgatatg |
25413466 |
T |
 |
| Q |
200 |
gatac |
204 |
Q |
| |
|
||||| |
|
|
| T |
25413467 |
gatac |
25413471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University