View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6617_low_4 (Length: 485)
Name: NF6617_low_4
Description: NF6617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6617_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 126 - 466
Target Start/End: Complemental strand, 18422997 - 18422656
Alignment:
| Q |
126 |
ttgatttgttgcctgtttattatcacatcactactctttgttccttcacatactttttacagatacaatttttcaagagacgattgtttaatactttctt |
225 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18422997 |
ttgatttgttgcttgtttattatcaccgcactactctttgtcccttcacatactttttacaggtacaatttttcaagagacacttgtttaatactttctt |
18422898 |
T |
 |
| Q |
226 |
ctttagggttttggtctagttcttcaaaatttgtcttcnnnnnnnnnnnnaataatatttaaagtgatgtgaaatgggtggagtggcaacatagttgaga |
325 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||| |||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
18422897 |
ctttagggttttggtctagtccttcaaaatttgtcttcttttttatttttaataatatataaaatgctgtgaaatgggtggagtggcaacatagttgaga |
18422798 |
T |
 |
| Q |
326 |
tatcatttatttcatttgatgttttttcaatctatatttagaaaaaattgtactgctgcc-nnnnnnnattgttaattgattaggtaattttggctaatc |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18422797 |
tatcatttatttcatttgatgttttttcaatctatatttagaaaaaattgcactgctgccttttttttattgttaattgattaggtaattttggctaatc |
18422698 |
T |
 |
| Q |
425 |
gattagatgtctaaaatttgagaaattattagaggttaatcg |
466 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18422697 |
gattagatgtctaaaatttgagaaattgttagaggttaatcg |
18422656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 78 - 119
Target Start/End: Original strand, 38060099 - 38060140
Alignment:
| Q |
78 |
aaatgctttcattagaaatagattgggtttacctgaatatag |
119 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
38060099 |
aaatgctttcataagaaatagattgagtttacctgaatatag |
38060140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University