View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6618_high_6 (Length: 249)
Name: NF6618_high_6
Description: NF6618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6618_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 3668920 - 3668691
Alignment:
| Q |
1 |
ttagaaaatatcttataatatctttatattatatagtagcatttaagtttatctcgcacgtcaatttattagaagacaagtcaatagaacggttcatgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3668920 |
ttagaaaatatcttataatatctttatatcatattgtagcatttaagtttatctcgcatgtcaatttattagaagacaagtcaatagaacggttcatgtt |
3668821 |
T |
 |
| Q |
101 |
cttgcaataatggatacatttttaacttggattcatattttatagatattataactcgtatccaacatattatcgttaatgaaatgcaatcaa-----ct |
195 |
Q |
| |
|
|||| ||||||||| |||||||||| | |||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||| || || |
|
|
| T |
3668820 |
cttgtaataatggacacatttttaattcagatttacattttatagatattataactcgtgtccaacatattatcgttaatgaaatgcaataaacatgtct |
3668721 |
T |
 |
| Q |
196 |
cgctcaaaataataatattaaaaaatatag |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3668720 |
tgctcaaaataataatattaaaaaatatag |
3668691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University