View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6618_high_9 (Length: 218)
Name: NF6618_high_9
Description: NF6618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6618_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 50201957 - 50202141
Alignment:
| Q |
19 |
agaatatcaacaacaacaactattggtaaagtaatctcaaagaaagttacaccattaaacagaactccttcccctaaagttgccattatcaaacggatat |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50201957 |
agaatatcaacaacaacaactgttggtaaagtaatctcaaagaaagttacaccattaaacagaactccttcccctaaagttgccattatcaaacggatat |
50202056 |
T |
 |
| Q |
119 |
tccgctcatcccgtggttaattagtaa-ttatacacaagttagaaagtaaccacatgtgcataagattcgtttagattgatttga |
202 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50202057 |
tccgctcatcccgtggttaattagtaatttatacacaggttagaaagtaaccacatgtgcataagattcggttagattgatttga |
50202141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University