View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6618_low_4 (Length: 341)
Name: NF6618_low_4
Description: NF6618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6618_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 17 - 319
Target Start/End: Original strand, 3438698 - 3439000
Alignment:
| Q |
17 |
aagatgtgctttagaagctcgtaagctacgagcttcatatcctcaggtttgttttactatgctgtttatgttgcttcattttgtttttcctaaaaaagtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438698 |
aagatgtgctttagaagctcgtaagctacgagcttcatatcctcaggtttgttttactatgctgtttatgttgcttcattttgtttttcctaaaaaagtg |
3438797 |
T |
 |
| Q |
117 |
gtgattaaagatcttttcttagacttaactttttctgttcttcaatgttggtgtaaaggctgttgacactttcttggaggagttgattgtgcggagagaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438798 |
gtgattaaagatcttttcttagacttaactttttctgttcttcaatgttggtgtaaaggctgttgacactttcttggaggagttgattgtgcggagagaa |
3438897 |
T |
 |
| Q |
217 |
cttgctgataacttttgctactatcagcctcattatgattcaatacaaggagcatgggagtgggctcgtaaaaccttactcgaccacgcctctgataagc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438898 |
cttgctgataacttttgctactatcagcctcattatgattcaatacaaggagcatgggagtgggctcgtaaaaccttactcgaccacgcctctgataagc |
3438997 |
T |
 |
| Q |
317 |
gac |
319 |
Q |
| |
|
||| |
|
|
| T |
3438998 |
gac |
3439000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University