View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6619_high_20 (Length: 321)
Name: NF6619_high_20
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6619_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 44 - 213
Target Start/End: Complemental strand, 2551456 - 2551287
Alignment:
| Q |
44 |
gttaatatgggactgtgtgacggagggagtaactttaaaaataaagaacatagaaggatctagaaagcgtggagatttgatttatttttattttggagaa |
143 |
Q |
| |
|
|||| ||||| | ||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551456 |
gttattatggtattgtgtgagggagggagtaactttaaaagtaaagagcatagaaggatctagaaagcgtggagatttgatttatttttattttggagaa |
2551357 |
T |
|
| Q |
144 |
tatataaatacaaaaacaaagttcagcgcagtgaaagaaccaatactatacttcaaaattttcaactcac |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551356 |
tatataaatacaaaaacaaagttcagagcagtgaaagaaccaatactatacttcaaaattttcaactcac |
2551287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 307
Target Start/End: Complemental strand, 2551218 - 2551190
Alignment:
| Q |
279 |
cttttttcgacgacgattttacactcgcc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2551218 |
cttttttcgacgacgattttacactcgcc |
2551190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University