View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6619_high_33 (Length: 244)
Name: NF6619_high_33
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6619_high_33 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 2 - 244
Target Start/End: Complemental strand, 9385370 - 9385121
Alignment:
| Q |
2 |
gatatgaatgatgaatagatttggcagacacggatcaaaacgcaaaactatgcgcgctaaggaaataaatgatgtgaaccttatcttttataggt----- |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9385370 |
gatatgaatgatgaatagatttggcagacacggatcaaaacgcaaaactatgcgcgctaaggaaataaatgatgtgaaccttatctt--ataggtgtatc |
9385273 |
T |
 |
| Q |
97 |
--atataaaaatagtgtaaatttagaaagaaatctatgtgatgtactctagtccacaagtgaacatgaagaagcatacaattccacatcccgtgataaag |
194 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9385272 |
ttatataaaaatagtgtaaatttagaaataaatctatgtgatgtactctagtccacaagtgaacatgaagaagcatccaattccacatcccgtgataaag |
9385173 |
T |
 |
| Q |
195 |
acgtttaggaccc--tcctccacattgcttcaaagatatgtccacaattatt |
244 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9385172 |
acgtttaggacccaagcctccacattgcttcaaagatatgtctacaattatt |
9385121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University