View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6619_high_37 (Length: 234)
Name: NF6619_high_37
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6619_high_37 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 22 - 234
Target Start/End: Complemental strand, 1947687 - 1947475
Alignment:
| Q |
22 |
atgactatgatattaatttgcgagagactctctatgtttttatcggtcaaaaatgtatttatgtcaatatttaaaacgttgaacattttttaaataaaaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1947687 |
atgactatgatattaatttgcgagagactctccatgtttttatcggtcaaaaatgtatttaagttaatatttaaaacgttgaacattttttaaataaaaa |
1947588 |
T |
 |
| Q |
122 |
acaactattctcaatataattttatggattgaattattttgtccattgaaaataaaatagtgttatagacattcttttttcaacatttattctattactt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1947587 |
acaactattctcaatataattttatggattgaattatttcgtccattgaaaataaaatagtgttatagacatttttttttcaacatttattctattactt |
1947488 |
T |
 |
| Q |
222 |
gatgaaatcgtgt |
234 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1947487 |
gatgaaatcgtgt |
1947475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University