View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6619_high_39 (Length: 229)

Name: NF6619_high_39
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6619_high_39
NF6619_high_39
[»] chr4 (2 HSPs)
chr4 (50-153)||(51433585-51433688)
chr4 (176-206)||(51433557-51433587)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 50 - 153
Target Start/End: Complemental strand, 51433688 - 51433585
Alignment:
50 ctgctaactggtaattctctcataactcatatcatatatgtatttttgattttaatcctatactttagtaatctagagttaggctaaaagttaagtaaaa 149  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||    
51433688 ctgctaactggtaattctctcataactcatatcatatatgtatttttggttttaatcctatactttagtaatctagagttcggcttaaagttaagtaaaa 51433589  T
150 ttat 153  Q
    ||||    
51433588 ttat 51433585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 206
Target Start/End: Complemental strand, 51433587 - 51433557
Alignment:
176 tatgtgtcttgctaaatatttctatttatac 206  Q
    |||||||||||||||||||||||||||||||    
51433587 tatgtgtcttgctaaatatttctatttatac 51433557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University