View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6619_high_41 (Length: 221)
Name: NF6619_high_41
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6619_high_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 207
Target Start/End: Original strand, 31046674 - 31046753
Alignment:
| Q |
128 |
tattcatgtagtggtttaacctttcgattagacaaatgttcaaaaagatcgaaccaattgataagttaatcggttctctg |
207 |
Q |
| |
|
||||||||||||||||||||| ||| || |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31046674 |
tattcatgtagtggtttaaccgttcaatcagacaaatgttcaaaaagatcgaaccaattgatatgttaatcggttctctg |
31046753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 31046564 - 31046616
Alignment:
| Q |
18 |
agactccatatcatatggttcaatcggttctcccaaggtttaatcaaatgatt |
70 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31046564 |
agactccatatcatatgcttcaatcggttctcccatggtttaatcaaatgatt |
31046616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University