View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6619_low_18 (Length: 333)
Name: NF6619_low_18
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6619_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 70 - 303
Target Start/End: Complemental strand, 35084102 - 35083873
Alignment:
| Q |
70 |
aaaatgatatagacaatcaatcaaaaaatttgaaccttagttgcattaagaaacaataagtaacatgcttaagatgataatctagtgcataccattgttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||| ||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
35084102 |
aaaatgatatagacaatcaatcaaaaaaattcaaccttgattgcattaagaaaca----gtaacatgcttaagatcataatctattgcataccattgttt |
35084007 |
T |
|
| Q |
170 |
cccagcagtatccttaagttgctgtgtcggtaacctgtttaattttatgggatcgttgggcggaacaaataggccattaaccaattctgaattgggtttc |
269 |
Q |
| |
|
||||||||||||||||| ||||||| || ||||| ||||||||||| | ||||| || || ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35084006 |
cccagcagtatccttaacttgctgtttcagtaacttgtttaattttctcggatcatttggaggaacaaatagcccattaaccaattctgaattgggtttc |
35083907 |
T |
|
| Q |
270 |
caaatagtggtacttggtgtgtttgtttgagatg |
303 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35083906 |
caaatagtgctacttggtgtctttgtttgagatg |
35083873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 268 - 322
Target Start/End: Original strand, 27690959 - 27691013
Alignment:
| Q |
268 |
tccaaatagtggtacttggtgtgtttgtttgagatggatcacctgttgcctttga |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27690959 |
tccaaatagtggtacttggtgtgtttgtttgagatggatcacctgttgcctttga |
27691013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University