View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6619_low_26 (Length: 283)
Name: NF6619_low_26
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6619_low_26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 8 - 283
Target Start/End: Original strand, 40374847 - 40375131
Alignment:
| Q |
8 |
gcagaacctgtgactattttacatgttatcgttcttgcttggaaagaggatatagagaggctgttattgaat---------tccttgcccttaatgtcat |
98 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40374847 |
gcagaacctatgactattttacatgttatcgttcttgcttggaaagaggatatagagaggctgttattgaataagatttgttccttgcccttaatgtcat |
40374946 |
T |
|
| Q |
99 |
tgtttcatgctccatcacactttaagagatgaaggttatttttactaattgactggtgaataagggaaattattgaagaggaccccctacgttccaatag |
198 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40374947 |
tgtttcatgttccatcacactttaagagatgaaggttatttgtactaattgactggcgaataagggaaattattgaagaggaccccctacgttccaatag |
40375046 |
T |
|
| Q |
199 |
cttggcaatgccagttttaattttcaaaattggcatttctctctttctccgttgtctccctaagatgaatatattggaatttgat |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40375047 |
tttggcaatgccagttttaattttcaaaattggcatttctctctttctccgttgtctccctaagatgaatatattggaatttgat |
40375131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University