View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6619_low_27 (Length: 271)
Name: NF6619_low_27
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6619_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 26126587 - 26126845
Alignment:
| Q |
1 |
agttgtgtgacggcagcaaggattttaactgagggagaagatgcatccggaaggtgacaagacgagtaatttgaagacaatgattaatgagtaatgaatt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26126587 |
agttgtgtaacggcagcaaggattttaactgagggagaagatgcatccggaaggtgacgagacgagtaatttgaagacaatgattaatgagtaatgaatt |
26126686 |
T |
 |
| Q |
101 |
tggaatatacttatgtttcagttttgagaggaaacgctaaaaggttacaaacctttctgtactaatgctaaaagatctcttgaatctttaggagtaaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26126687 |
tggaatatacttatgtttcagttttgagaggaaacgccaaaaggttacaaacctttctgtactaatgctaaaagatctcttgaatctttaggagtaaatt |
26126786 |
T |
 |
| Q |
201 |
aggcaatgtggatagaacactgctgtgagtgacattgctcaattattgaagttgatatt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26126787 |
aggcaatgtggatagaacactgctgtgagtgacattgctcaattattgaagttgatatt |
26126845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 153
Target Start/End: Original strand, 45512837 - 45512893
Alignment:
| Q |
97 |
aatttggaatatacttatgtttcagttttgagaggaaacgctaaaaggttacaaacc |
153 |
Q |
| |
|
|||| |||||| || |||||||||||||||||||| || || |||| |||||||||| |
|
|
| T |
45512837 |
aattaggaatacacctatgtttcagttttgagagggaatgccaaaatgttacaaacc |
45512893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University