View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6619_low_28 (Length: 266)
Name: NF6619_low_28
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6619_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 138 - 249
Target Start/End: Original strand, 37916312 - 37916423
Alignment:
| Q |
138 |
tatgctcctcagtcgcccttggaacggatgttgtgtgtagtgactttggtgagttgtttcttctgcttcttcgacaaatgagaagtaaaatgttcgtttg |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
37916312 |
tatgctcctcagtcgcccttggaacgggtgttgtgtgtagtgactttggtgagttgtttcttctgcttcttcaacaaatgaggagtaaaatgttcgtttg |
37916411 |
T |
 |
| Q |
238 |
aagcgtcatttt |
249 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37916412 |
aagcgtcatttt |
37916423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 37916174 - 37916215
Alignment:
| Q |
1 |
acattaagaggagactcagacatctaacaagattggcacctc |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37916174 |
acattaagaggagactcagacatctaacaagattggcacctc |
37916215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University