View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6619_low_31 (Length: 251)
Name: NF6619_low_31
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6619_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 1947493 - 1947320
Alignment:
| Q |
1 |
ttacttgatgaaatcgtgtggattccaccacttttatgttttaatggatgtattgaactttttaaaagaatttcactaaactaatggattgttttcaccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1947493 |
ttacttgatgaaatcgtgtggattccaccacttttatgttt-aatggatgtattgaatttttttaaagaatttcactaaactaatggattgttttcaccc |
1947395 |
T |
 |
| Q |
101 |
atcgattccaattcatctaatctatcaactttgctacatgtacctatgtatcaaattgtatcctagtgctctctc |
175 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1947394 |
atccattccaattcatctaatctatcaactttgctacatgtacctatgtatcaaattgtatcctagtgctctctc |
1947320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University